Reminder: Login to access new features and members-only content!

Register to be a member of our community. Its easy!

Register a new account

Already a member?

Log In here!

Donate

Did you find our content interesting or helpful? Help support the IPFD enhance health, well-being and welfare for dogs everywhere.

Jump to content
  •   Language
  • Sign Up

International Partnership for Dogs - Enhancing Dog Health, Well-Being, and Welfare - Join Us.

Dilated Cardiomyopathy, (DCM); Schnauzer

Breeds

Relevance Rating: Some evidence for test being meaningful for these breeds

General

Disease Name
Dilated Cardiomyopathy, (DCM); Schnauzer
Mutation
c.2472_2493delGAAGGTCAAAATCTGCCCAGA
Mutation 2
c.2472_2493del
Test Type
Genetic Disease/Disorder
Details
"This disease condition is a frequent cause of disability and premature death in dogs. Breed-to-breed differences in ages at onset, survival times, inheritance patterns, and myocardial histopathology, are indicative of major genetic contributions... Although DCM has probably occurred in most if not all dog breeds, several reports have focused on the DCM-associated epidemiology, clinical characteristics, laboratory findings and histopathology in certain breeds with a high prevalence of the disease including Boxer, Doberman Pinscher, Great Dane, Irish Wolfhound, Newfoundland, and Portuguese Water Dog. The ages at onset of clinical signs ranged from 0.9 to 2.9 years. The familial relationships between affected dogs was consistent with an autosomal recessive mode of inheritance. Here we report that a whole genome sequence from one of the affected Standard Schnauzers contained a rare an RBM20 deletion and frameshift that is the apparent cause of DCM in the breed." [From Gilliam et al. 2016]
Published
Gilliam, H. Douglas Jr. (2016): Molecular Genetic Studies of Canine Inherited Diseases Including Sams, Neuronal Ceroid Lipofuscinosis and Dilated Cardiomyopathy. A Dissertation presented to the Faculty of the Graduate School University of Missouri.
×
×
  • Create New...

Important Information

By using this site, you agree to our Terms of Use.